View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17337_low_2 (Length: 237)
Name: NF17337_low_2
Description: NF17337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17337_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 165
Target Start/End: Original strand, 19479310 - 19479458
Alignment:
| Q |
17 |
attaagattatttatttaattgttttcttctaattatccattgctatggcttaggctaattgggtctgctatgagactatttctcaagtcgaaatgggac |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19479310 |
attaggattatttatttaattgttttcttctaattatccattgctatggcttaggctaattgggtctgctatgagactatttctcaagtcgaaatgggac |
19479409 |
T |
 |
| Q |
117 |
atttactatctcaaaagttggtgacttcacgagtcaaactagtggattg |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19479410 |
atttactatctttaaagttggtgacttcacgagtcaaactcgtggattg |
19479458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University