View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17339_low_3 (Length: 317)
Name: NF17339_low_3
Description: NF17339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17339_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 7 - 299
Target Start/End: Complemental strand, 4956772 - 4956480
Alignment:
| Q |
7 |
tagataattctccatcagacgatgattttgaggatattcatggttttggatttctaatggatttgcgtaatcgttttgaactttcaatcccttccacata |
106 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4956772 |
tagataattctccaacagacgatgattatgaggatattcatggttttggatttctaatggatttgcgtaatcgttttgaactttcaattccttccacata |
4956673 |
T |
|
| Q |
107 |
ttttggaaattgtttatcattttgtcttgcaacactaccaaagaggaagttagtgggagaaaatggtatatgtgaagcagcaaatattattggaagagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4956672 |
ttttggaaattgtttatcattttgtcttgcaacactaccaaagaggaagttagtgggagaaaatggtatatgtgaagcagcaaatattattggaagagaa |
4956573 |
T |
|
| Q |
207 |
ataagtttgaaagatcctttaaaagaagataaagagtttaacaagtctttgaatatgattcgtgtaatagggtcaccaaagtttgatgtgtat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4956572 |
ataagtttgaaagatcctttaaaagaagataaagagtttaacaagtctttgaatatgattcgtgtaatagggtcaccaaagtttgatgtgtat |
4956480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University