View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1733_low_12 (Length: 204)
Name: NF1733_low_12
Description: NF1733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1733_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 7 - 187
Target Start/End: Original strand, 36328530 - 36328708
Alignment:
| Q |
7 |
taaatcatacaattacaatataaatggtagttaatcataaaagtggcttatttggaagnnnnnnnnnnnnnnnnnnnctcatgggatacagccacttggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36328530 |
taaatcatacaattacaatataaatggtagttaatcataaaagtggcttatttggaa--aaaaaaagacaaaaaaaactcatgggatacagccacttggt |
36328627 |
T |
 |
| Q |
107 |
acacatgtacgtactcattctactgatgctccgaatcttctcttataaagacggcaaattccatataagcttcatttttct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36328628 |
acacatgtacgtactcattctactgatgctccgaatcttctcttataaagtcggcaaattccatataagcttcatttttct |
36328708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University