View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1733_low_9 (Length: 236)

Name: NF1733_low_9
Description: NF1733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1733_low_9
NF1733_low_9
[»] chr7 (1 HSPs)
chr7 (1-220)||(45258371-45258590)


Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 45258371 - 45258590
Alignment:
1 aaccaaacactgtcacaaacaaaacttttaactccagaaaacagatttcttgctgcaaccttacatatcccaattgtttccaaaatgatgaatgaatgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45258371 aaccaaacactgtcacaaacaaaacttttaactccagaaaacagatttcttgctgcaaccttacatatcccaattgtttccaaaatgatgaatgaatgaa 45258470  T
101 tactacttatcttcaacaacacacaggacaaacatagcttcttcctgcaactatgtctacaatcaggtcccatatcccaattctttgccaaatagtaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45258471 tactacttatcttcaacaacacacaggacaaacatagcttcttcctgcaactatgtctacaatcaggtcccatatcccaattctttgccaaatagtaaat 45258570  T
201 gaaccttacagaatttcttg 220  Q
    ||||||||||||||||||||    
45258571 gaaccttacagaatttcttg 45258590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University