View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734-Insertion-2 (Length: 263)
Name: NF1734-Insertion-2
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734-Insertion-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 263
Target Start/End: Original strand, 41980599 - 41980853
Alignment:
| Q |
7 |
ataattatatacgtgtaggttatgagatttctccaacgtttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980599 |
ataattatatacgtgtaggttatgagatttctccaacgtttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgatt |
41980698 |
T |
|
| Q |
107 |
gctatatatattgttcacattggttgtaattgatgatttcctccggtttcatttcttcttataagnnnnnnnagcgactttttagtaagttattatgaat |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41980699 |
gc--tatatattgttcacattggttgtaattgatgatttcctccggtttcatttcttcttataagtttttttagcgactttttagtaagttattatgaat |
41980796 |
T |
|
| Q |
207 |
gggaattgggagcaattggattctgtagagttttgggatattgtcctacatatcatg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41980797 |
gggaattgggagcaattggattctgtagaattttgggatattgtcctacatatcatg |
41980853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University