View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734-Insertion-7 (Length: 300)
Name: NF1734-Insertion-7
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 16921458 - 16921253
Alignment:
| Q |
8 |
gcgctgccgaagaaataggatcagtttgatattgtggtagccctttcaaaccagaaagatgatgagtttgtgttgaagagaaatcaaattgttgttcttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16921458 |
gcgctgccgaagaaataggatcagtttgatattgtggtagccctttcaaaccagaaagatgatgagtttgtgttgaagagaaatcaaattgttgttcttg |
16921359 |
T |
|
| Q |
108 |
atgagttgttaatggaagaagcggcggaacgagaaaagattgtgatgatgtgaaatctatagaagctgaaatgtcattgtcaagatcttcttgtgaatca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16921358 |
atgagttgttaatggaagaagcggcggaacgagaaaagattgtgatgatgtgaaatctatagaagctgaaatgtcattgtcaagatcttcttgtgaatca |
16921259 |
T |
|
| Q |
208 |
aagata |
213 |
Q |
| |
|
|||||| |
|
|
| T |
16921258 |
aagata |
16921253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 32553967 - 32553895
Alignment:
| Q |
142 |
aaagattgtgatgatgtgaaatctatagaagctgaaatgtcattgtcaagatcttcttgtgaatcaaagataa |
214 |
Q |
| |
|
|||||| ||||| || ||||||||| || || |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32553967 |
aaagatggtgatagtgagaaatctattgaggcagaaatgtcattgtcaatttcttcttgtgaatcaaagataa |
32553895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University