View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17340_low_3 (Length: 349)
Name: NF17340_low_3
Description: NF17340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17340_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 5368600 - 5368417
Alignment:
| Q |
3 |
tatcgatgcatgatatgataggatattggtacgtcattcatttttaagtatatgggcttcagagcccgctaatctactttgatnnnnnnnnn-------- |
94 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
5368600 |
tatcgatgcaggatacgataggatattggtacgtcattcatttttaagtatatgggcttcggagcccactaatctactttgatgaaaaataaaaaaaaaa |
5368501 |
T |
 |
| Q |
95 |
tcataagtatttgtctcaaacgaattttttatcgaagcattatcttttttggtgaaataaattaagaatagggtgcgaatacgt |
178 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5368500 |
tcataagtatttgtcccaaacgaattttttatcgaagcattatcttttttggtgaaacaaattaagaatagggtgcgaatacgt |
5368417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 227 - 332
Target Start/End: Complemental strand, 5368370 - 5368265
Alignment:
| Q |
227 |
caattatattaaatgtttgaatttcaaattcaaaacactacgcatgtttgggttgatgatggcatcagcagaatcgtggtaaactattgtaattttggta |
326 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5368370 |
caattatattaaatgattgaatttcaaattcaaaacactacgcatgtttcggttgatgatggcatcagcagaatcgtggtaaactattgtaattttggca |
5368271 |
T |
 |
| Q |
327 |
aggaat |
332 |
Q |
| |
|
|||||| |
|
|
| T |
5368270 |
aggaat |
5368265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University