View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17340_low_8 (Length: 280)
Name: NF17340_low_8
Description: NF17340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17340_low_8 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 1475 - 1534
Alignment:
| Q |
18 |
gaaccgaggaaatgaaatttattttnnnnnnnggacatttgattgatgtgtttattttat |
77 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1475 |
gaaccgaagaaatgaaatttattttaaaaaaaggacatttgattgatgtgtttattttat |
1534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University