View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17341_high_2 (Length: 276)
Name: NF17341_high_2
Description: NF17341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17341_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 6001076 - 6001321
Alignment:
| Q |
18 |
aatacagcttcggaagaagtcaaagaagctcccagcaggttcagtgcctaacagaatagcaaaa-ataacaagtcattacttctcacaattttaataatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001076 |
aatacagcttcggaagaagtcaaagaagctcccagcaggttcagggtctaacagtatagcaaaaaataacaagtcattacttctcacaattttaataatg |
6001175 |
T |
|
| Q |
117 |
aacatgcataacttttgtaaacaaaggtatatctcacgctcaactgcggagacatttgatattatagtaatcaatattgcttagtaaattcattgataat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001176 |
aacatgcataacttttgtaaacaaaggtatatctcacgctcaactgcggagacatttgatattatagtaatcaatattgcttagtaaattcattgataat |
6001275 |
T |
|
| Q |
217 |
aatcattctatttcaaagtatcaatattcaagagtaaattagtgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001276 |
aatcattctatttcaaagtatcaatattcaagagtaaattagtgtt |
6001321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 29 - 66
Target Start/End: Original strand, 6010372 - 6010409
Alignment:
| Q |
29 |
ggaagaagtcaaagaagctcccagcaggttcagtgcct |
66 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6010372 |
ggaagaagtcaaagaagctcccaacaggttcagtgcct |
6010409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University