View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17342_high_10 (Length: 259)
Name: NF17342_high_10
Description: NF17342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17342_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 63 - 243
Target Start/End: Complemental strand, 48690373 - 48690193
Alignment:
| Q |
63 |
ttcaatactttatgaaaaatcttacgctctttataaaacacaattcaataattttaaaactgacagcacatctattgtatgtgctacgtctgttttttca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690373 |
ttcaatactttatgaaaaatcttacgctctttataaaacacaattcaataattttaaaactgacagcacatctattgtatgtgctacgtctgttttttca |
48690274 |
T |
 |
| Q |
163 |
acttttccataatgcagttataagttttttggtcttaaaaagaagggtgctgctgccccactagctcatttattttgtttc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690273 |
acttttccataatgcagttataagttttttggtcttaaaaagaagggtgctgctgccccactagctcatttattttgtttc |
48690193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 48690446 - 48690393
Alignment:
| Q |
13 |
agaatataaatgatttgtaattgtagtatatggtagggcaatttgcaacattca |
66 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48690446 |
agaatatgaatgatttgtaattgtagtatatggtacggcaatttgcaacattca |
48690393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University