View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17342_high_7 (Length: 317)
Name: NF17342_high_7
Description: NF17342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17342_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 40 - 307
Target Start/End: Complemental strand, 6512722 - 6512456
Alignment:
| Q |
40 |
gttgatgtgggaaggatgaatgggagataaggagaagaatacctactggaattgaggggtttagtacgaacatgaatgagaatgcaattagagttcttct |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6512722 |
gttgatgtgagaaggatgaatgggagataaggagaagaatacctactggaattgagaggtttggtacgaacatgaatgagaatgcaattggagttcttct |
6512623 |
T |
 |
| Q |
140 |
ttagaaggtggtccaccgcccatttcaccgcgcactggctattccgaccggtgttgatggcaatgacggtggttttggcggcggtggcagctcctaattc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6512622 |
ttagaaggtggtccaccgcccatttcaccgcgcactggctattccgaccggtgttgatggcaatgacggtggttttggcggcggtggcagctcctaattc |
6512523 |
T |
 |
| Q |
240 |
attagtaatcatttgcatgaagaattaaggttagttacttttttagaaaaaataagctcttgtctctg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6512522 |
attagtaatcatttgcatgaagaattaaggttagttacttttttaga-aaaataagctcttgtctctg |
6512456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University