View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17342_low_15 (Length: 250)
Name: NF17342_low_15
Description: NF17342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17342_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 34917141 - 34917368
Alignment:
| Q |
9 |
aatttgtttcataatgggtgtagtattgattctctactagatgatatgcaatgtgctgaagctgatcaaattatggaaggnnnnnnncattttgatgttg |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34917141 |
aatttgtttcaaaatgggtgtagtattgattctctactagatgatatgcaatgtgctgaagctgatcaaattatggaaggaaaaaaacattttgatgttg |
34917240 |
T |
|
| Q |
109 |
agacagaaatgccattggatattatggaatctatgcttggagttgaagttaagaaggagatggatttgatggagatggttttttcaggtcaacgaaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34917241 |
agacagaaatgccattggatattatggaatctatgcttggagttgaagttaagaaggagatggatttgatggagatggttttttcaggtcaacgaaaatt |
34917340 |
T |
|
| Q |
209 |
ttcaagtgactcattttttggtaatgac |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34917341 |
ttcaagtgactcattttttggtaatgac |
34917368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 21549361 - 21549311
Alignment:
| Q |
9 |
aatttgtttcataatgggtgtagtattgattctctactagatgatatgcaa |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21549361 |
aatttgtttcaagatgggtgtagtattgattctctgctagatgatatgcaa |
21549311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University