View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_high_36 (Length: 247)
Name: NF17343_high_36
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_high_36 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 39210439 - 39210667
Alignment:
| Q |
19 |
aggctcgacactgatgatcgatagggatgttaatccacaagggcgatcacactacccttttctggatctgcatcttgccgagagaaattgaatttgggtg |
118 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39210439 |
aggctcgacaccgatgattgatagggatgttaatccacaagggcgatcacactacccttttctggatctgcatcttgccgagagaaattgaatttgagtg |
39210538 |
T |
 |
| Q |
119 |
ggggaaggatagcaacgttcgatgtttaagagagaaattgattgnnnnnnncaatgagagagaagtgagaaagagacttttatgtctctcttatatgtat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210539 |
ggggaaggatagcaacgttcgatgtttaagagagaaattggttgtttttttcaatgagagagaagtgagaaagagacttttatgtctctcttatatgtat |
39210638 |
T |
 |
| Q |
219 |
gtattatcaacaaagaatcaacaattctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39210639 |
gtattatcaacaaagaatcaacaattctt |
39210667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University