View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_high_41 (Length: 239)
Name: NF17343_high_41
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 4488777 - 4488563
Alignment:
| Q |
10 |
gtagataattctcttttgattaggtcttagacgaatttattttaagttgtttgaatcatataattactgaacacttttctacgcaataacaaatctagta |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4488777 |
gtagctaattctcttttgattaggtcttagacgaatttattttaagttgtttgaatcatataattactgaacacttttctacgcaataacaaacctagta |
4488678 |
T |
 |
| Q |
110 |
ttattcagttatatttgttcttcatgcnnnnnnnatattgatgaatatatgaattgatctaaagtcttaagtgattactaacataacttttaaactcggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4488677 |
ttattcagttatatttgttcttcatgctttttttatattgatgaatatatgaattgatctaaagtcttaagtgttcactaacataacttttaaactcggt |
4488578 |
T |
 |
| Q |
210 |
cttatatgattgttg |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4488577 |
cttatatgattgttg |
4488563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University