View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17343_high_48 (Length: 228)

Name: NF17343_high_48
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17343_high_48
NF17343_high_48
[»] chr3 (3 HSPs)
chr3 (4-91)||(47417613-47417700)
chr3 (155-211)||(47417764-47417820)
chr3 (3-48)||(47406930-47406975)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 47417613 - 47417700
Alignment:
4 tttggcacaaatggaaatacgacggatattactaattcaagttcaagcgcaaagataacgacttggagtgtacaaggaccccaattgg 91  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47417613 tttggcacaaatggaaataccacggacattactaattcaagttcaagcgcaaagataacgacttggagtgtacaaggaccccaattgg 47417700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 47417764 - 47417820
Alignment:
155 gtaggaactagagccctactctaagtctggttcttggactcataaccaatatctgtg 211  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
47417764 gtaggaactagagccctactctaagtctggttcttggactcacaaccaatatctgtg 47417820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 47406930 - 47406975
Alignment:
3 ttttggcacaaatggaaatacgacggatattactaattcaagttca 48  Q
    |||||||||||||||||||| ||| ||||||||||| |||||||||    
47406930 ttttggcacaaatggaaatatgactgatattactaactcaagttca 47406975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University