View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_high_52 (Length: 219)
Name: NF17343_high_52
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 7887604 - 7887417
Alignment:
| Q |
15 |
tatactataagtcacttggttaactctttcatttccccctttttaggttcatgtttgtcagattttaaaacttttccttttacctgtttcattaaatgcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7887604 |
tatactataagtcacttggttaactctttcatttccccctttttaggttcatgtttgtcaggttttaaaactttgccttttacctgtttcattaaatgcc |
7887505 |
T |
|
| Q |
115 |
tcattggctttcacttaaaccactcaagnnnnnnnnnnnnnatgaaatggtaactcataatcattaattgaaaactatcaagtataag |
202 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7887504 |
tcgttggctttcacttaaaccactcaagttttttcctttttatgaaatggtaactcataatcattagttgaaaactatcaagtataag |
7887417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 67 - 142
Target Start/End: Complemental strand, 7918479 - 7918405
Alignment:
| Q |
67 |
gtttgtcagattttaaaacttttccttttacctgtttcattaaatgcctcattggctttcacttaaaccactcaag |
142 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||| ||||||||| || |||| |||||| |||||||||||| |
|
|
| T |
7918479 |
gtttgtcaggttttgaaactttgccttttacctgtttgattaaatgcttc-ttgggtttcaccgaaaccactcaag |
7918405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University