View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_low_36 (Length: 283)
Name: NF17343_low_36
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 267
Target Start/End: Original strand, 4189237 - 4189485
Alignment:
| Q |
15 |
ctgtgtagaccaaaccaaatgttatgattatttcagtaacaactcctccaattggtcctacttcagctgctacactgtggattggagtttcctgtcaaca |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189237 |
ctgtgtataccaaaccaaatgttatgattatttcagtaacaactcctccaattggtcctacttcagctgctacactgtggattggagtttcctgtcaaca |
4189336 |
T |
 |
| Q |
115 |
aatcacaatattagttcagcatattatattataatcttaactataatgaactcaacattatgttattcttggacttcgtatatagtattaatattagcac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189337 |
aatcacaatattagttcagcatattatattataatcttaactataatgaactcaacattatgttattcttggacttcgtatatagtattaatattagcac |
4189436 |
T |
 |
| Q |
215 |
attaggataatcttaacaaaggattatttatgacagctaattgtagagtcatc |
267 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
4189437 |
attaggataatcttaacaaagga----ttatgacagctaattgtaaagtcatc |
4189485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University