View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_low_41 (Length: 250)
Name: NF17343_low_41
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 79 - 242
Target Start/End: Complemental strand, 2752983 - 2752820
Alignment:
| Q |
79 |
ttaaagtaccaaagattatgaacaaagagagtattagttatatcatgaaatgcttaataaaaacatgttatcaaatggaaaatgcttaatttcgcgaagg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752983 |
ttaaagtaccaaagattatgaacaaagagagtattagttatatcatgaaatgcttaataaaaacatgttatcaaatggaaaatgcttaatttcgcgaagg |
2752884 |
T |
|
| Q |
179 |
gacacttcacaattatttaatgagtgatacgatcctctcttggacactttaactcattcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2752883 |
gacacttcacaattatttaatgaatgatacgaccctctcttggacactttaactcattcatctc |
2752820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 2753560 - 2753506
Alignment:
| Q |
1 |
cgaaatatacacgtcgagcatatatcactgatatatcatatatcatcttcaaata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2753560 |
cgaaatatacacgtcgagcatatatcactgatatatcatatatcatcttcaaata |
2753506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University