View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17343_low_43 (Length: 245)
Name: NF17343_low_43
Description: NF17343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17343_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 42419455 - 42419675
Alignment:
| Q |
17 |
gaaagagactcaatcggatacgacgtcgttatcgtcggagctggtcccgccggtttatcggcggcgatacggttgaaacaactttgccgcgaaaatgata |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42419455 |
gaaagagactcaatcgaatacgacgtcgttatcgtcggagctggtcccgccggtttatcggcggcgatacggttgaaacaactttgccgcgaaaatgata |
42419554 |
T |
 |
| Q |
117 |
ccgatttatctgtttgtgttcttgaaaaaggttctgaagttggtaagtcaacttcgtttctctttcagttaatttgttgctacnnnnnnnnngctctatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
42419555 |
ccgatttatctgtttgtgttcttgaaaaaggttctgaagttggtaagtcaacttcgtttctctttcagttaatttattgctac-aaaaaaaagctctatt |
42419653 |
T |
 |
| Q |
217 |
aattgatttcgcaatttctgtg |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42419654 |
aattgatttcgcaatttctgtg |
42419675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University