View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17345_low_11 (Length: 237)
Name: NF17345_low_11
Description: NF17345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17345_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 143 - 231
Target Start/End: Original strand, 51294866 - 51294954
Alignment:
| Q |
143 |
ccaatattttattatgtaacaactccgtcttgttttattttggttagcnnnnnnnatgttaaggaaatatttagggtttaggttattta |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51294866 |
ccaatattttattatgtaacaactccgtcttgttttattttggttagctttttttatgttaaggaaatatttagggtttaggttattta |
51294954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 51294747 - 51294784
Alignment:
| Q |
27 |
tactaatatgattacaatgacattgaatatcaaaataa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294747 |
tactaatatgattacaatgacattgaatatcaaaataa |
51294784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University