View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17345_low_15 (Length: 218)
Name: NF17345_low_15
Description: NF17345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17345_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 33358143 - 33358052
Alignment:
| Q |
10 |
gtgagatgaaaatgattggaaataagtcaacttaaaacgtctataactatagttagaaaactcgttcttgagtgggaactagtttcatttgaa |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
33358143 |
gtgatatgaaaatgattggaaataagtcaacttaaaacgtctataactatagttagaaaactcgttattgagt-ggaactagtttcatttgaa |
33358052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 114 - 201
Target Start/End: Complemental strand, 33357486 - 33357389
Alignment:
| Q |
114 |
aatagtttctccatattagatttcatagtcttaccatgtatc----------ggctccgtgaacacaactaatatgtctcaaagtttaacgtaacatc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
33357486 |
aatagtttctccatattagatttcatagtcttaccatgtatctacatgtatcggctccgtgaacacaactaatatgacacaaagtttaacgtaacatc |
33357389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University