View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17346_high_4 (Length: 216)
Name: NF17346_high_4
Description: NF17346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17346_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 2473540 - 2473363
Alignment:
| Q |
17 |
aaatacccaggttacattgttttcatcaaatagtcaccaataagtggtgaatcaataaggtacgtaacaatgcatgcgtgcccctagggctggtgttttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2473540 |
aaatacccaggttacattgttttcatcaaatagttaccaataagtggtgaatcaataaggta----acaatgcatgcgtgcccctagggctggtgttttt |
2473445 |
T |
 |
| Q |
117 |
tagtgggactggttttgttctgaatttcatgaatgtacttgcccttggtcaacatctagaatgaacaatggtacatgaagcc |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2473444 |
tagtgggactggttttgttctgaatttaatgaatgtacttgcccttggtcaacatctagaatgaacaatggtacatgaagcc |
2473363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University