View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17346_low_6 (Length: 217)
Name: NF17346_low_6
Description: NF17346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17346_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 23928465 - 23928650
Alignment:
| Q |
11 |
gaataatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23928465 |
gaataatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttga |
23928564 |
T |
 |
| Q |
111 |
aaaccaacaacgggacgactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg |
196 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23928565 |
aaaccagcaacgggacaactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg |
23928650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University