View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17347_low_5 (Length: 241)
Name: NF17347_low_5
Description: NF17347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17347_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 5796562 - 5796462
Alignment:
| Q |
1 |
tttatttgatactatggatctgtgttgtattcatatagctgaattattgtgggtgagattcatgcagttaaactagtaaggttttagaacttgggttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5796562 |
tttatttgatactatggatctgtgttgtattcatatagctgaattattgtgggtgagattcatgcagttaaactagtaaggttttagaacttgggttgtt |
5796463 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
5796462 |
c |
5796462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 164 - 230
Target Start/End: Complemental strand, 5796399 - 5796333
Alignment:
| Q |
164 |
aataattgttgtagaaatttggaagtgagatggaaaatattatgtaatttgattaaaccatattctt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5796399 |
aataattgttgtagaaatttggaagtgagatggaaaatattatgtaatttgattaaaccattttctt |
5796333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University