View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17347_low_7 (Length: 205)
Name: NF17347_low_7
Description: NF17347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17347_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 11 - 185
Target Start/End: Original strand, 9069745 - 9069919
Alignment:
| Q |
11 |
gaacctgtggaaaactgatggctttcatcgatggtggtgagaatggtgtgttcgattctgaagggatcagaggttgacgacgacgttggtgagaacgacg |
110 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
9069745 |
gaacctgtagaaaactgatggatttcatcgacggtggtgagaatggtgtgttcagatctgaagggattagaggttgacgacgacgttggtgagaatgacg |
9069844 |
T |
|
| Q |
111 |
tgatggtgaggattatggtagtggcgatgacgcagtgtgtggtggcaaggacggtagaggtgattgacgagtaca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9069845 |
tgatggtgaggattatggtagtggcgatgatgcagtgtgtggtggcaaggacggtagaggtgattgacgagtaca |
9069919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 32219730 - 32219653
Alignment:
| Q |
40 |
gatggtggtgagaatggtgtgttcgattctgaagggatcagaggttgacgacgacgttggtgagaacgacgtgatggt |
117 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||| ||||| || ||||||| ||||||| ||||||| ||||| |
|
|
| T |
32219730 |
gatggtggtgagaaaggagtgttcagatctgaagggattggaggtcgatgacgacgatggtgaggacgacgtaatggt |
32219653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University