View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17348_low_20 (Length: 201)
Name: NF17348_low_20
Description: NF17348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17348_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 28926901 - 28927066
Alignment:
| Q |
14 |
gaacgaaagactattccagaactcatgaacttaacgttttattcaacaacaggtgtaagggaaaaaatgcaaaggagttcgatatagaatcaaccttcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
28926901 |
gaacgaaagactattccagaactcatcaacttaacgttttattcaacaacaggtgtaagggaaaaaatgcaaatgagttcgatatagaatcaacctccaa |
28927000 |
T |
 |
| Q |
114 |
tcaaaccaataagggatactacatgggaatgaaatcaaataaaacaatactacttacaattgtgtcacagac |
185 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28927001 |
tcaaaccaataaggga---tacatgggaatgaaatcaaataaaacaa---tacttacaattgtgtcacagac |
28927066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University