View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17349_low_7 (Length: 272)
Name: NF17349_low_7
Description: NF17349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17349_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 22 - 261
Target Start/End: Original strand, 31455215 - 31455454
Alignment:
| Q |
22 |
acgtagaagacgaggaaattcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaactt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31455215 |
acgtagaagacgaggaaattcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaactt |
31455314 |
T |
 |
| Q |
122 |
agtgaaatgaagaaaatggaaaacaaagtaaagcttttttctattatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctacca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455315 |
ggtgaaatgaagaaaatggaaaacaaagtaaagcttttttctattatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctacca |
31455414 |
T |
 |
| Q |
222 |
ccatcacaatatctatatttcgttctcttttactattcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455415 |
ccatcacaatatctatatttcgttctcttttactattcat |
31455454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University