View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_28 (Length: 362)
Name: NF1734_high_28
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 31069529 - 31069460
Alignment:
| Q |
151 |
agagacacaagtgaagaatagggggaatggttttgaagcttaacatcaccttgctgaaggaagaagacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069529 |
agagacacaagtgaagaatagggggaatggttttgaagcttaacatcaccttgctgaaggaagaagacat |
31069460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 31069661 - 31069596
Alignment:
| Q |
19 |
attcttgagttctaccgtcatttctcttcccacaaaatctttcaagtagcagaagaacaacttcat |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31069661 |
attcttgagttctaccgtcatttctcttcccgcaaaatctttcaagtagcagaagaacaacttcat |
31069596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 283 - 342
Target Start/End: Complemental strand, 31069397 - 31069338
Alignment:
| Q |
283 |
ctattatcttcttatttatattaacgaaatgtgttgagatgaatcttgtgatattccttg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069397 |
ctattatcttcttatttatattaacgaaatgtgttgagatgaatcttgtgatattccttg |
31069338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 37614398 - 37614334
Alignment:
| Q |
20 |
ttcttgagttctaccgtcatttctcttcccacaaaatctttcaagtagcagaagaacaacttcat |
84 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||||||| ||||| ||||||||| |||||| |
|
|
| T |
37614398 |
ttcttgagttcaaccgtcacttctcttcccaccaaatctttgaagtacgagaagaacagcttcat |
37614334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 42440506 - 42440446
Alignment:
| Q |
20 |
ttcttgagttctaccgtcatttctcttcccacaaaatctttcaagtagcagaagaacaact |
80 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
42440506 |
ttcttgagttctaccgtaacttctcttcccaccaaatctttgaagtatgagaagaacaact |
42440446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University