View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_29 (Length: 361)
Name: NF1734_high_29
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 81 - 350
Target Start/End: Complemental strand, 41980492 - 41980223
Alignment:
| Q |
81 |
catgcaaagagtattgggatttaaacctcagaggtgtctcggagagagtataaagcattgctatcttttctcgctgatgaaaccaatattccacaacctc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41980492 |
catgcaaagagtattgggatttaaacctcagaggtgtctcggagagagtataaagcattgctatcttttctcactgatgaaaccaatattccacaacctc |
41980393 |
T |
 |
| Q |
181 |
gattgctctcccgcagcacctaaatacagtcaaaaattttagaattataatctgtctgcagattaaagagaaaatagaaaatgttattctagactaatta |
280 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980392 |
gattgctctcccgcagcacctaaatacattcaaaaattttagaattataatctgtctgcggattaaagagaaaatagaaaatgttattctagactaatta |
41980293 |
T |
 |
| Q |
281 |
aatccaataccttgaatgcgtcttcatctgttttatcatctccaatgtagataggaagcacatcattcat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980292 |
aatccaataccttgaatgcgtcttcatctgttttatcatctccaatgtagataggaagcacatcattcat |
41980223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University