View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_50 (Length: 264)
Name: NF1734_high_50
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 1348458 - 1348705
Alignment:
| Q |
1 |
accgaacgaagaaacatggtgtttacacataaattctttaattttagaaccacaagtgttttgcaacggaaaatggttagcgccaaagggacgtgtaaca |
100 |
Q |
| |
|
||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
1348458 |
accgaactacgaaacatggtgtttacacgtaaattctttaattttagaaccacaagtgttttgcaatggaaaatggttggggccaaagggacgtgtaaca |
1348557 |
T |
|
| Q |
101 |
aatttagatagagatcctcaacaccacgatgttttgctgcttttatccagtcgttaaaaccgaaacaataagtcccccagagttacgaaccacatgttag |
200 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1348558 |
agtttagatagagatccacaacaccacgatgttttgctgcttttatccagtcgttaaaaccgaaacaataagtcccccagagtttcgaaccacatgttag |
1348657 |
T |
|
| Q |
201 |
atgaaaagatttgagggtttgtagttgcgcaggtggggagagcattac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1348658 |
atgaaaagatttgagggtttgtagttgcgcaggtggggagagcattac |
1348705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University