View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_61 (Length: 249)
Name: NF1734_high_61
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 53 - 188
Target Start/End: Complemental strand, 51938568 - 51938435
Alignment:
| Q |
53 |
taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938568 |
taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac |
51938469 |
T |
|
| Q |
153 |
gtattgacgatgactgtggtaaaagagaaatagaat |
188 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
51938468 |
gta--gacgatgactgtggtaaaagaaaaatagaat |
51938435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University