View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_67 (Length: 237)
Name: NF1734_high_67
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 10680027 - 10680227
Alignment:
| Q |
17 |
cataggaaaaagtttgctgttggatggaatagaatttttgtcaattgnnnnnnnngtagaggcctaatgagtatggtgaggaatcatactatatataaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680027 |
cataggaaaaagtttgctgttggatggaatagaatttttgtcaattgaaaaaaaagtagaggcctaatgagtatggtgaggaatcatactatatataaat |
10680126 |
T |
|
| Q |
117 |
tgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcaagctacagctgctctgtcgatgcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
10680127 |
tgcttaatactaaacatgattactaaacatgtacatgatgcaagacacgacattcattattcaatgcaagactcgagctacagctactctgtcgatgcac |
10680226 |
T |
|
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
10680227 |
g |
10680227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University