View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_73 (Length: 231)
Name: NF1734_high_73
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 20818013 - 20818199
Alignment:
| Q |
13 |
tctgtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttgctatgttttctgcaaaaagaaaatttattctgcagaggca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20818013 |
tctgtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttactatgttttctgcaaaaagaaaatttattctgcagatgca |
20818112 |
T |
|
| Q |
113 |
atcgttttttcaccgtaagtttgatttttccttttacaagaaaagaattcgaaaggtatgcctgcatcacatgctcttatgttttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
20818113 |
atcgttttttcaccgtaagtttgatttttccttttacaagaaaagaatttgaaaggtatgcctgcatcacatactcttctgttttct |
20818199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University