View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_78 (Length: 227)
Name: NF1734_high_78
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 31524320 - 31524530
Alignment:
| Q |
1 |
ctgtacgtgtattctcctgttttggacaaacaaatccaaggaccatacattgagaagaaagaacctttgaaaatcccgggttgtaaatcagttcaaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31524320 |
ctgtacgtgtattctcctgttttggacaaacaaatccaaggaccatacattgagcagaaagaacctttgaaaatcccgggttgtaaatcagttcaaccaa |
31524419 |
T |
|
| Q |
101 |
atgacttggttgatccaatgctggaccggtacaacttggagtataaagagtacttagccgtagcgaaaaacttttccaaaagcgatgccatcttagttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31524420 |
atgacttggttgatccaatgctggaccggtacaacttggagtataaagagtacttaaccgtagcgaaaaacttctccaaaagcgatgccatcttagttaa |
31524519 |
T |
|
| Q |
201 |
cacgtgggatg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
31524520 |
cacgtgggatg |
31524530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University