View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_80 (Length: 220)
Name: NF1734_high_80
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 42 - 219
Target Start/End: Complemental strand, 51938356 - 51938179
Alignment:
| Q |
42 |
aatgatcgttgcaattgcattgtatttttgtcaactcttagcaaaactcaatggcagacaaggagacaacaaaagagaagaatggatcagatttcagaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938356 |
aatgatcgttgcaattgcattgtatttttgtcaactcttagcaaaactcaatggcagacaaggagacaacaaaagagaagaatggatcagatttcagaaa |
51938257 |
T |
 |
| Q |
142 |
tggaacaactattgacaacgttgttgggcgtcgtgggctacccatgatccaaacccacaagaaagttatggattcttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938256 |
tggaacaactattgacaacgttgttgggcgtcgtgggctacccatgatccaaacccacaagaaagttatggattcttc |
51938179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 51938407 - 51938375
Alignment:
| Q |
1 |
gtaaacatgaagctaacgtgtactacaactcat |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
51938407 |
gtaaacatgaagctaacgtgtaccacaactcat |
51938375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University