View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_high_82 (Length: 218)
Name: NF1734_high_82
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_high_82 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 218
Target Start/End: Complemental strand, 40520141 - 40519929
Alignment:
| Q |
6 |
aagtattaatcaataaaaagcttactaaatgtgaaattaatttattagaatcaaaattttagtttacattttgtataacacatattttcagataaattca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520141 |
aagtattaatcaataaaaagcttactaaatgtgaaattaatttattagaatcaaaattttagtttacattttgtataacacatattttcagataaattca |
40520042 |
T |
|
| Q |
106 |
ctagaaacagcttatggagcagtgctttcagatatttatgacgacttgggagttaaggggatgcaacaaagttgtattatgaagattccaagtaagcaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||| |
|
|
| T |
40520041 |
ctagaaacagcttatggagcagtgctttcagatatttatgacgacttgggagttaaggggatgcaacaaagttgtattatgaagcttccatgtcagcaat |
40519942 |
T |
|
| Q |
206 |
tcagatccaacaa |
218 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
40519941 |
tcagctccaacaa |
40519929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 92 - 195
Target Start/End: Complemental strand, 40511061 - 40510958
Alignment:
| Q |
92 |
ttcagataaattcactagaaacagcttatggagcagtgctttcagatatttatgacgacttgggagttaaggggatgcaacaaagttgtattatgaagat |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || ||||||||||||||| |||||| || |||||||||| ||||||| ||| ||||||||||||||| | |
|
|
| T |
40511061 |
ttcagataaattcactagaaacaggttatgaaggagtgctttcagatatgtatgacaacatgggagttaaagggatgccacatagttgtattatgaagct |
40510962 |
T |
|
| Q |
192 |
tcca |
195 |
Q |
| |
|
|||| |
|
|
| T |
40510961 |
tcca |
40510958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University