View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_14 (Length: 447)
Name: NF1734_low_14
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 8e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 184 - 431
Target Start/End: Original strand, 52887854 - 52888111
Alignment:
| Q |
184 |
cttcaattcattggccaccctcctttcttcactgtactttcctttctcctcgggcaactccaatttcctttctttactctctgccactttgcaatgccct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52887854 |
cttcaattcattggccaccctcctttcttcactgtactttcctttctcctcgggcaactccaatttcctttctttactctctgccactttgcaatgccct |
52887953 |
T |
|
| Q |
284 |
gttcctgttttaactcacttttcccttaattcatataaattccggaattgcagaattttcaaact----------ttgnnnnnnnnnnnnaaaaccaatc |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
52887954 |
gttcctgttttaactcacttttcccttaattcatataaattccggaattgcagaattttcaaactttttttttttttttttttttttttaaaaaccaatc |
52888053 |
T |
|
| Q |
374 |
aatttcaggttctttgttctttctctatattctaaactaaacccctttggctttttct |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888054 |
aatttcaggttctttgttctttctctatattctaaactaaacccctttggctttttct |
52888111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 36 - 108
Target Start/End: Original strand, 52887719 - 52887791
Alignment:
| Q |
36 |
atatgtcagtcttgcctatatctacacactctctcaacggaccttttccttttatcttccttctcccgtgacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52887719 |
atatgtcagtcttgcctatatctacacactctctcaacggaccttttccttttatcttccttctcccgtgacc |
52887791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University