View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_18 (Length: 435)
Name: NF1734_low_18
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 6780976 - 6781077
Alignment:
| Q |
18 |
tttagaaagacaggtgagtgaagttctctctagctttccctattacttatctgtggtaaaacaactaaactgtacttcaattgctgataacaatctgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6780976 |
tttagaaagacaggtgagtgaagttctctctagctttccctattacttatctgtggtaaaacaactaaactgtacttcaattgctgataacaatctgatt |
6781075 |
T |
 |
| Q |
118 |
at |
119 |
Q |
| |
|
|| |
|
|
| T |
6781076 |
at |
6781077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 185 - 267
Target Start/End: Original strand, 12634750 - 12634832
Alignment:
| Q |
185 |
ataagcactttacccgattctgttctctgtcacattctctcttttctcgaaaccaaacaagcggttgccacaagcattctttc |
267 |
Q |
| |
|
||||||||||| || ||| | |||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
12634750 |
ataagcactttcccagatccaattctgtgtcacattctctcttttctcgaaaccaaacaatccgttgccacaagtattctttc |
12634832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 264
Target Start/End: Original strand, 12539855 - 12539919
Alignment:
| Q |
200 |
gattctgttctctgtcacattctctcttttctcgaaaccaaacaagcggttgccacaagcattct |
264 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||||| | | ||||||||||||||| |
|
|
| T |
12539855 |
gattctgttatctgccacattctctcttttctccctaccaaacaatctgctgccacaagcattct |
12539919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 41663074 - 41663022
Alignment:
| Q |
188 |
agcactttacccgattctgttctctgtcacattctctcttttctcgaaaccaa |
240 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
41663074 |
agcactttaccggatgcaattctctgtcacattctctctttcctcgaaaccaa |
41663022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University