View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_38 (Length: 331)
Name: NF1734_low_38
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 20 - 326
Target Start/End: Complemental strand, 41640595 - 41640289
Alignment:
| Q |
20 |
tgtgagccctaatgttttactttatgtagttatagtgtattttgggaaggttatagttgcgtgttatgtccctattgggagtcttggagtcctttgatta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41640595 |
tgtgagccctaatgttttactttatgtagttatagtgtattttgggaaggttatagttgcgtgttatgtccctattgggagtcttggagtcctttgatta |
41640496 |
T |
|
| Q |
120 |
tgtggtgctgttttatcgtggaaacaattccttattttgggtacaagctagataatgcattttttggattggattcgtccctccaactgaaatgtggttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41640495 |
tgtggtgctgttttatcgtggaaacaattccttattttgagtacaagctagataatgcattttttggattggattcgtccctcaaactgaaatgtggttc |
41640396 |
T |
|
| Q |
220 |
ccttactttttagttttgagttatatatggaccaatggaaattctttagtgtgttgtaaaattgtgggtcatatttttgtttccacacttcatatcccta |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41640395 |
ccttactttttagttttgagttatatatggaccaatggaaattctttagtgtgttgtaaaattgtgggtcatatttttgttaccacacttcatatcccta |
41640296 |
T |
|
| Q |
320 |
tgctact |
326 |
Q |
| |
|
|| |||| |
|
|
| T |
41640295 |
tgatact |
41640289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University