View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_40 (Length: 304)
Name: NF1734_low_40
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 3402190 - 3402332
Alignment:
| Q |
19 |
aagtagcacaacccacctcgaccgcaagaaacggtgatgcgaaggaaggagggagaagctcctcatcccaccaccaagatcacggttacatcttgaacgg |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3402190 |
aagtagcacaacccacctcgactgcaagaaacggtgatgcgaaggaaggagggagaagctcctcatcccaccaccaagatcacggttacatcttggacgg |
3402289 |
T |
|
| Q |
119 |
ggagggtttggattgtgtcgggaggaaggcggctggaggattt |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3402290 |
ggagggtttggattgtgtagggaggaaggcggctggaggattt |
3402332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 201 - 290
Target Start/End: Original strand, 3402372 - 3402461
Alignment:
| Q |
201 |
ttacgttacacctctataatactataatgtaacaattttactatatgatgaggatcaatatggagttttctcttggccccttgcgctacc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3402372 |
ttacgttacacctctataatactataatgtaacaattttactatatgatgaggatcaatatggagttttctcttggccccttgcgctacc |
3402461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University