View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_46 (Length: 281)
Name: NF1734_low_46
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 7902717 - 7902466
Alignment:
| Q |
11 |
agcagaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902717 |
agcaaaacctgtgtcattgctagctggcaactgtggaaggatgggttggacagtgtttgggatgtctttgtattgaagtatagctgtagcagttttgttg |
7902618 |
T |
 |
| Q |
111 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902617 |
tcaacttgaattggggcatccataaaagccttggtggccacaaagtacctaccagcaacttgattggcatgaaccagaacgtttgtggtttgaccaggag |
7902518 |
T |
 |
| Q |
211 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902517 |
caattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctc |
7902466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 259
Target Start/End: Complemental strand, 7892269 - 7892196
Alignment:
| Q |
186 |
agaacgtttgtggtttgaccaggagcaattagtatagcctgagtggtgaatggttttgtataaacagcatcaac |
259 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| || | || || |||||||||||||| ||||| |||||||| |
|
|
| T |
7892269 |
agaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaaactgcatcaac |
7892196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University