View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_47 (Length: 279)
Name: NF1734_low_47
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 263
Target Start/End: Complemental strand, 10603732 - 10603485
Alignment:
| Q |
14 |
agaggagataaaaaaggtttacggggttatgggtcgtttttggagtcccaggatctgtctaccgccaaaggacggcagtcctgagattaataaactatat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10603732 |
agaggagataaaaaaggtttacggggttatgggtcgtttttggagtcccaggatctgtctaccgccaaatgacggcagtcctgagattaataaactatat |
10603633 |
T |
|
| Q |
114 |
gctgagatatcggaatttataaaatatatgttgggctacatccatttttgatacccttggattccattgcagattctcctcaacaatgatttagaattct |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10603632 |
gctgagatatcggaatttataaa--atatgttgggctacatccatttttgatacccttggattccattgcacattctcctcaacaatgatttagaattct |
10603535 |
T |
|
| Q |
214 |
agaatattgttggcggtgttgtgagtcaatgaagactatagtactcttta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603534 |
agaatattgttggcggtgttgtgagtcaatgaagactatagtactcttta |
10603485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 20210539 - 20210511
Alignment:
| Q |
193 |
tcaacaatgatttagaattctagaatatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20210539 |
tcaacaatgatttagaattctagaatatt |
20210511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University