View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_50 (Length: 267)
Name: NF1734_low_50
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 49584299 - 49584060
Alignment:
| Q |
15 |
gagaatggtaagtgggaattcacttgggatgaggattcacttcttttacagctgaaagatggtcttggtgatgatgttgaaacaatctatattggttgtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584299 |
gagaatggtaagtgggaattcacttgggatgaggattcacttcttttacagctgaaagatggtcttggtgatgatgttgaaacaatctatattggttgtc |
49584200 |
T |
|
| Q |
115 |
ttaaagaagaaattgatccaattgagcaagatgatgttgctcagttcttgcttgacaatttcaaatgtgtaccaactttccttccacctgaacttttcac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584199 |
ttaaagaagaaattgatccaattgagcaagatgatgttgctcagtacttgcttgacaatttcaaatgtgtaccaactttccttccacctgaacttttcac |
49584100 |
T |
|
| Q |
215 |
taaattctatcatggtttctgtaaacaacatctatggcct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584099 |
taaattctatcatggtttctgtaaacaacatctatggcct |
49584060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 11698415 - 11698339
Alignment:
| Q |
165 |
cttgacaatttcaaatgtgtaccaactttccttccacctgaacttttcactaaattctatcatggtttctgtaaaca |
241 |
Q |
| |
|
||||| |||||||||||||| || ||||| |||||||||||| | || || || | |||||||||||| || ||||| |
|
|
| T |
11698415 |
cttgagaatttcaaatgtgtccctacttttcttccacctgaaatgtttaccaagtactatcatggtttttgcaaaca |
11698339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University