View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_51 (Length: 265)
Name: NF1734_low_51
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 32202384 - 32202134
Alignment:
| Q |
1 |
tacaattatacatgcgagttagatcgcccagtggctgcaaggtcataaaatcgtccgatcctacaatctaactcgcggccttaacaacgagaactagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32202384 |
tacaattatacatgcgagttagatcgcccagtggctttaaggtcataaaatcgtccgatcctacaatctaactcgcggccttaacaacgagaactagaat |
32202285 |
T |
 |
| Q |
101 |
gacgataaaatggtcactagcacaaaaggatgataaataggcagagtaattggtaccaaattgggagggatttgtgacatatgccctataaattatctct |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32202284 |
gacgataaaatggtcactagcaaaaaaggatgataaataggcagagtaattggtaccaaa-tgggagggatttgtgacatatgccctataaattatctct |
32202186 |
T |
 |
| Q |
201 |
caaccaccacctacatatcctccctaatagatgcatttttcctatcctgcct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32202185 |
caaccaccacctacatatcctccctaatagatgcatttttcctatcctgcct |
32202134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University