View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_low_53 (Length: 260)

Name: NF1734_low_53
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_low_53
NF1734_low_53
[»] chr6 (5 HSPs)
chr6 (1-245)||(24188931-24189175)
chr6 (1-245)||(24179125-24179369)
chr6 (7-245)||(24168689-24168927)
chr6 (10-230)||(24151877-24152097)
chr6 (7-71)||(24112748-24112812)


Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 24189175 - 24188931
Alignment:
1 agtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagggtc 100  Q
    |||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||    
24189175 agtactgcttctccgtcttcatattgcgacggatagcgatgctctggtgcaagtcggtagttgacggagacaatgacagcggagatttcccggcagagtc 24189076  T
101 tacgacaaaccgcatcggagaggttcgaggaagaagagagaaaagtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtgga 200  Q
    ||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24189075 tacgacaaaccgcatcgtagaggtttgaggaagaagaaagaaaagtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtgga 24188976  T
201 accaccatcttcggtgacttctccggcaacagttggagtaaagag 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
24188975 accaccatcttcggtgacttctccggcaacagttggagtaaagag 24188931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 24179369 - 24179125
Alignment:
1 agtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagggtc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
24179369 agtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagagtc 24179270  T
101 tacgacaaaccgcatcggagaggttcgaggaagaagagagaaaagtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtgga 200  Q
    |||| ||||| || ||| ||||||||||||||| ||| ||||||||| ||||||| |||||||||||||||||||| ||||||||||| | ||||||||     
24179269 tacggcaaacagcgtcgtagaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgacgacaggaagggaggttgctttggtggc 24179170  T
201 accaccatcttcggtgacttctccggcaacagttggagtaaagag 245  Q
    |||||||||| |||||||||||||||||||||| || ||||||||    
24179169 accaccatctccggtgacttctccggcaacagtgggggtaaagag 24179125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 24168927 - 24168689
Alignment:
7 gcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagggtctacgac 106  Q
    |||||||||||||| ||||| |||||||| | |||||| ||||| || ||||||||||| |||||||  ||| |||| |||||||||||| ||||||| |    
24168927 gcttctccgtcttcgtattgcgacggatagcaatgctccggtgtgaggcggtagttgacagagacaacaacaacggatatttcccggcagagtctacggc 24168828  T
107 aaaccgcatcggagaggttcgaggaagaagagagaaaagtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtggaaccacc 206  Q
    |||  |||||  ||  | | ||||| |   | ||| | ||||||||||||||||||||||||||||| |||||||||||||| |||||||| | ||||||    
24168827 aaaaagcatcatagtagatagaggaggggcaaagataggtgaagccaccaccgtggaagaaaatgacaacgggaagggaggttgttttggttgcaccacc 24168728  T
207 atcttcggtgacttctccggcaacagttggagtaaagag 245  Q
    |||| ||  |||||||||| ||||||| || ||||||||    
24168727 atctccgacgacttctccgccaacagtgggtgtaaagag 24168689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 24152097 - 24151877
Alignment:
10 tctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagggtctacgacaaa 109  Q
    ||||| || |||||||| |||||||| | |||||| |||||||| ||||||||||| ||||| |  |||||| | | ||||| |||| ||||||| || |    
24152097 tctccatcatcatattgcgacggatatctatgctccggtgtaaggcggtagttgacagagacgacaacagcgaaaacttccctgcagagtctacggcata 24151998  T
110 ccgcatcg-gagaggttcgaggaagaagagagaaaagtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtggaaccaccat 208  Q
      |||||| || || || ||||| |  || |||||| |||||||||||||||||||| |||||| ||| ||||||||||| ||||| |||| ||||||||    
24151997 aagcatcgtgatagatt-gaggagggggaaagaaaactgaagccaccaccgtggaagtaaatgatgacaggaagggaggttgttttagtggcaccaccat 24151899  T
209 cttcggtgacttctccggcaac 230  Q
    || | || || |||||||||||    
24151898 ctccagtaacctctccggcaac 24151877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 24112812 - 24112748
Alignment:
7 gcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagac 71  Q
    |||||||||||||| ||||| || |||||||||||||| |||||  | |||||||||||||||||    
24112812 gcttctccgtcttcgtattgcgatggataccgatgctccggtgtgtgacggtagttgacggagac 24112748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University