View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1734_low_72 (Length: 236)
Name: NF1734_low_72
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1734_low_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 208
Target Start/End: Original strand, 34005564 - 34005680
Alignment:
| Q |
110 |
atcataactttacgaatgctttatatatctaaagcaatggatgcaaattg------------------atcattgataaaggatagcacactcattgaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34005564 |
atcataactttacgaatgctttatatatctaaagcaatggatgcaaattgatgaattggaggcacaaaatcattgataaaggatagcacactcattgaat |
34005663 |
T |
|
| Q |
192 |
caaaatagcaattaaaa |
208 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34005664 |
caaaatagcaattaaaa |
34005680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 34005304 - 34005349
Alignment:
| Q |
10 |
cagaagaaaaagctaaggcctaagaaataaaactctgctatactat |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34005304 |
cagaagaaaaagctaaggcctaagaaataaaactcagctatactat |
34005349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University