View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1734_low_75 (Length: 231)

Name: NF1734_low_75
Description: NF1734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1734_low_75
NF1734_low_75
[»] chr3 (1 HSPs)
chr3 (13-199)||(20818013-20818199)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 20818013 - 20818199
Alignment:
13 tctgtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttgctatgttttctgcaaaaagaaaatttattctgcagaggca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||    
20818013 tctgtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttactatgttttctgcaaaaagaaaatttattctgcagatgca 20818112  T
113 atcgttttttcaccgtaagtttgatttttccttttacaagaaaagaattcgaaaggtatgcctgcatcacatgctcttatgttttct 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||    
20818113 atcgttttttcaccgtaagtttgatttttccttttacaagaaaagaatttgaaaggtatgcctgcatcacatactcttctgttttct 20818199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University