View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17350_high_8 (Length: 376)

Name: NF17350_high_8
Description: NF17350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17350_high_8
NF17350_high_8
[»] chr7 (2 HSPs)
chr7 (72-376)||(10194107-10194415)
chr7 (8-45)||(10194435-10194472)
[»] chr1 (1 HSPs)
chr1 (8-45)||(19459235-19459272)


Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 72 - 376
Target Start/End: Complemental strand, 10194415 - 10194107
Alignment:
72 aacgcatttaaaggtaaatatgatgaaagacaagcgaagtgcaaaagatccgatcactacttatacggtttagggttttct---------tgtcaattat 162  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||    
10194415 aacgcatttaaagataaatatgatgaaagacaagcgaagtgcaaaagatccgatcactacttatacggtttagggttttctggtttttcttgtcaattat 10194316  T
163 aatttgcgatctatgatcaaacactgttaggcggcatgttcagtaacagatgagttcgaattccttgatcctgatatcaggatgcctggaatggtgttag 262  Q
    |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10194315 aatttgcgatttatgatcaaacactgttaggctgcatgttcagtaacagatgagttcgaattccttgatcctgatatcaggatgcctggaatggtgttag 10194216  T
263 ggacagaaaattttgataagttccatgttgcagtgaatgcaattgatgcgatgcagtttatgacaaattgcaataccagattatgtactactggtataag 362  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |     ||||||||||||||||||||||||||||||||||||||||||||||    
10194215 ggacagaaaattttgataagttccatgttgcagtgaatgcaattgattc-----agtttatgacaaattgcaataccagattatgtactactggtataag 10194121  T
363 gttatagaacacat 376  Q
    ||||||||||||||    
10194120 gttatagaacacat 10194107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 10194472 - 10194435
Alignment:
8 tgagatgaactgtgctggcttgagttttggaaacaaag 45  Q
    |||||||| |||||||||||||||||||||||||||||    
10194472 tgagatgagctgtgctggcttgagttttggaaacaaag 10194435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 19459235 - 19459272
Alignment:
8 tgagatgaactgtgctggcttgagttttggaaacaaag 45  Q
    |||||||| |||||||||||||||||||||||||||||    
19459235 tgagatgagctgtgctggcttgagttttggaaacaaag 19459272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University