View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_high_16 (Length: 324)
Name: NF17351_high_16
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 50530483 - 50530188
Alignment:
| Q |
11 |
cacagacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactcc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530483 |
cacacacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactcc |
50530384 |
T |
|
| Q |
111 |
ctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgcgttcgagctaggtccggtaacagcatgcgcaaaaccctccgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
50530383 |
ctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgtgttcgagctaggtccggcaacagcatgcgcaaaagcctccgt |
50530284 |
T |
|
| Q |
211 |
tggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttcc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530283 |
tggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttcc |
50530188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University