View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17351_high_26 (Length: 262)
Name: NF17351_high_26
Description: NF17351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17351_high_26 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 14443095 - 14442835
Alignment:
| Q |
1 |
cttttgtatgcactctctccttcagatccctctgatcaacctatcaatgttgttgctgctgctccttattactcggtaatctttcaattatttcaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14443095 |
cttttgtatgcactctctccttcagatccctctgatcaacctatcaatgttgttgctgctgctccttattactcggtaatctttcaattatttcaattat |
14442996 |
T |
 |
| Q |
101 |
ataactcactaaacttttctgagataagctcagnnnnnnnngaaggattgttttaaattgttattgcgatctttgtatttagtttttaaatttacgcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
14442995 |
ataactcactaaacttttctgagataagctcag-aaaaaaagaaggattgttttaaattgtgattgcgatctttgtatttagttttgaaattttcgcaag |
14442897 |
T |
 |
| Q |
201 |
gcgctgttatgtgacactcccaaattcttttacaaacgaattaattaccactaataataata |
262 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14442896 |
gcggtgttatgtgacactaccaaattcttttacaaacgaattaattaccactaataataata |
14442835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 14433647 - 14433594
Alignment:
| Q |
32 |
ctgatcaacctatcaatgttgttgctgctgctccttattactcggtaatctttc |
85 |
Q |
| |
|
||||||| |||||||||||| || || || |||||||||||||||| ||||||| |
|
|
| T |
14433647 |
ctgatcaccctatcaatgttatttctcctactccttattactcggtgatctttc |
14433594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University